Search found 264 matches

Return

Re: Gaming thoughts of the day

^
If Xenoblade were a woman, Dorian would have another reason to dislike it.
by Calshot
Tue Aug 21, 2012 8:25 pm
 
Jump to forum
Jump to topic

You are not authorised to read this forum.
by Guest
 
Jump to topic

Re: What Game/Games Are You Currently Playing?

Played the demo for the PSN release of Jojo's Bizarre Adventure. Absolutely loved it. Didn't really know what I was doing, but it was fun as hell anyway. I'll be keeping my eye out for the old Dreamcast release of it now.

I have the Dreamcast game and it's mighty fun. I recommend reading the manga in order to get all the references and tiny bits of fan-service they added (like you said you did for FotNS).

http://i.imgur.com/7YLWs.jpg

About to start this.
by Calshot
Fri Aug 24, 2012 6:12 pm
 
Jump to forum
Jump to topic

Re: Sailor Moon

I was rather fond of Sailor Pluto until she got demoted.
by Calshot
Sun Aug 26, 2012 4:50 pm
 
Jump to forum
Jump to topic

Re: Community

I just saw the season finale.

I can't count the reasons I should stay. One by one they all just fade away.
Image
by Calshot
Thu May 09, 2013 8:38 pm
 
Jump to forum
Jump to topic

Re: Anti-jokes

Jeff walks into the Dojo.

Nobody likes Jeff.

Jeff leaves.
by Calshot
Fri Sep 07, 2012 8:52 pm
 
Jump to forum
Jump to topic

Re: SEGA/Nintendo Console wars..anime?

One of the comments listed the characters as

GIA - Sonic the Hedgehog
OPUL - Fantasy Zone
NERU - Phantasy Star
TEJILOF - Tetris
RAMSES - Columns
MARCSE - Super Mario Bros.
GREEGE - Luigi
ZERIG - Legend of Zelda
CARVAI - Kirby
FARE - Fire Emblem
MASA - Mother
SAROID - Metroid
PIRIKA - Pokemon
FOSTA - Star Fox

These are based on franchises/titles, not necessarily characters. Most of them seem to have some sort of pun or loose reference in their name that's hard to make out once the name has been romanized. Example:


Fosta is written フォスタ. Star Fox is written スターフォックス. Now take スターフォ ックス and scramble that around.
by Calshot
Tue Sep 11, 2012 3:46 am
 
Jump to forum
Jump to topic

Re: Great Videogame Music

[youtube]http://www.youtube.com/watch?v=FcxllvjUo2k[/youtube]
by Calshot
Sun Sep 30, 2012 6:21 pm
 
Jump to forum
Jump to topic

Re: What Game/Games Are You Currently Playing?

I hadn't played played Virtua FIghter 5: Final Showdown in a month or two, so I picked it up while I was waiting for something to finish downloading on my computer.

I did a few license challenges until I hit a roadblock in the form of Jacky. I normally have trouble with Jacky players online, but when I couldn't beat an AI version, I was pissed.

I noticed the download was finished, so I played a quick online match. My opponent? A Jacky player. After a hard fought battle, I beat him with a near-perfect final round. I saved the replay and logged off of PSN in triumph.
by Calshot
Fri Oct 05, 2012 8:26 pm
 
Jump to forum
Jump to topic

Re: What TV Series Are You Watching

I've been watching the new Thundercats series. It's pretty good. It's a shame that it is on hiatus.

I still can't believe that Robin Atkin Downes (Travis Touchdown from No More Heroes among other roles) is Mumm-ra.
by Calshot
Sun Oct 07, 2012 11:17 pm
 
Jump to forum
Jump to topic

Re: Shenmue 1080p

KiBa wrote:
Who Really Cares? wrote:
Spokane wrote: I always wondered what the old guy in green did business wise, the name of his shop is kind of odd and gives no hint to the nature of his business.



Whore house.


Goodhead Fortunetellers.


Palms aren't just for reading.
by Calshot
Wed Oct 10, 2012 12:29 am
 
Jump to forum
Jump to topic

Re: Random Thoughts! v2.0

I wonder if Kevin Conroy's resume just says "I'm Batman" on it and nothing else.
by Calshot
Wed Oct 10, 2012 2:29 am
 
Jump to forum
Jump to topic

Re: What movie are you watching right now?

The Mist was on TV. I enjoyed it.

I haven't seen a horror movie since I watched Trollhunter around a year ago. Probably going to watch a few more to get into the Halloween spirit. Any suggestions?
by Calshot
Fri Oct 26, 2012 11:32 pm
 
Jump to forum
Jump to topic

Re: How do you imagine the final fight between Lan Di and Ry

Ryo pulls out his gun and shoots Lan Di. Then Ryo rides off into the sunset on his bicycle.
by Calshot
Sat Oct 27, 2012 6:06 pm
 
Jump to forum
Jump to topic

Re: Assassins Creed Series

^
Damn, Ezio could have saved alot of money on parachutes if he just learned to flap his arms.
by Calshot
Sun Oct 28, 2012 4:17 pm
 
Jump to forum
Jump to topic

Re: Gaming thoughts of the day

KiBa wrote: Somebody summon the Dorian. I can't take it anymore. That Pole is an integral part of my playground.


Dorian. Dorian. Dorian.

Image
by Calshot
Tue Oct 30, 2012 8:57 pm
 
Jump to forum
Jump to topic

Re: What Game/Games Are You Currently Playing?

Played the Gravity Rush demo yesterday at Target. It was really fun. It'll be the first game I get for Vita (years from now when the Vita is cheap).
by Calshot
Fri Nov 02, 2012 7:56 pm
 
Jump to forum
Jump to topic

Re: Assassins Creed Series

I really want to play ACIII but right now holding off getting too many games. Taking game buying slow right now as TBH a bit burned speed collecting. Also trying to save money. Getting Xmas gifts early for my mom and family. That said AC1 looks to buggy for me. So can I start with ACII and skip over the Rev/brotherhood? Most likely pick these up later down the line unless I crack. Also looks like a fun game for my Vita and want to give my vita some love(FUCK ME I LOVE MY VITA..ehem sorry)


I think you can safely skip Assassin's Creed 1. It gets repetitive and it feels somewhat lifeless. I wouldn't skip Brotherhood/Revelations if I were you. Though they aren't numbered, they're both fully fledged titles that directly continue the plot.

If you jumped directly from Assassin's Creed 2 to Assassin's Creed 3, you'd be pretty lost.
by Calshot
Sat Nov 03, 2012 4:39 am
 
Jump to forum
Jump to topic

Re: PS4 small leap in power less costly *RUMOR*

^
You should have prepared your anus before it went into Oblivion.
by Calshot
Mon Nov 05, 2012 5:19 pm
 
Jump to forum
Jump to topic

Re: What Anime are you watching right now?

I was sitting in the lab for my molecular biology class and the professor had written down an example of a DNA sequence of a certain allele. It went something like this:

CCCTCATTCATTCATTCATCA

In my sleep-deprived state of my mind, I read that as

ATATATATATATATATATATATAT

For the next five minutes I wondered what class would be like if Kenshiro taught it before realizing that I should probably be paying attention.
by Calshot
Thu Nov 08, 2012 10:52 pm
 
Jump to forum
Jump to topic

Re: Random Thoughts! v2.0

The democratic party candidate for Washington state's 4th legislative district (which covers Spokane Valley) was Amy Biviano.
http://i.imgur.com/rWdMW.jpg

Being that this is politics, somehow a topless Playboy picture of her from 1995 surfaced.

NSFW obviously.
http://i.imgur.com/HiSlM.jpg

Uncensored link
by Calshot
Sat Nov 10, 2012 7:41 pm
 
Jump to forum
Jump to topic

Re: Happy Birthday Topic

MiTT3NZ wrote: Never trust a pimp. Especially one who claims to have clean hoes. Fell for it once and now my dick grows mushrooms.


So you get 1-Up every time you get one up?
by Calshot
Mon Nov 12, 2012 11:29 pm
 
Jump to forum
Jump to topic

Re: What Song Are You Listening To Now?

[youtube]http://www.youtube.com/watch?v=-pK0Lqqg-sE[/youtube]
by Calshot
Mon Nov 12, 2012 8:44 pm
 
Jump to forum
Jump to topic

Re: Gaming thoughts of the day

Has anyone ever used Zazzle.com here?
I kept trying to find a good Assassin's Creed poster but wasn't finding anything I particularly liked, so I just went about trying to get one made from an image I like. Just put the order in with them.
Seemed like a good site. Just wondering if anyone has any experience with them.

You could use a program called Rasterbator as an alternative.

It blows up a picture you provide, divides it into a grid, and prints it page by page which you assemble back together like a mosaic.

http://i.imgur.com/jje65.gif http://i.imgur.com/OnyTy.jpg

Only downside is how much ink it consumes. I haven't done the math, but it might be cheaper using Rasterbator and doing the printing at a printing store rather than going through Zazzle.
by Calshot
Wed Nov 21, 2012 12:28 am
 
Jump to forum
Jump to topic

Re: What Game/Games Are You Currently Playing?

Finally got back to playing Broken Sword: Shadow of the Templars. I've been switching the audio language to French whenever I'm playing as Nicole and then back to English when I'm playing as George to make the game feel a bit more realistic.
by Calshot
Mon Nov 26, 2012 5:22 am
 
Jump to forum
Jump to topic

Re: Assassins Creed Series

I had the PS3 version and I don't remember it being that buggy at all.

You might have just struck out and got a bad copy.
by Calshot
Fri Nov 30, 2012 7:31 pm
 
Jump to forum
Jump to topic

Re: Epic Names in History

One of my favorite teachers in grade school was named Harry Sachs.

I knew a girl in elementary school named My Ho.
by Calshot
Fri Dec 07, 2012 5:40 pm
 
Jump to forum
Jump to topic

Re: What Game/Games Are You Currently Playing?

I'm having a bit of trouble installing Psychonauts , so I just finished Broken Sword: Shadow of the Templars instead.

Favorite dialogue of the game
*Ominous Chanting*

George: What could they be doing in there?

Nico: It could be some sort of satanic sex ritual.

George: Well, what are we waiting for?
by Calshot
Mon Dec 10, 2012 2:05 am
 
Jump to forum
Jump to topic

Re: Assassins Creed Series

I'm incredibly tempted to put "nothing is true, everything is permitted" on the true or false section of my finals.
by Calshot
Tue Dec 11, 2012 1:15 pm
 
Jump to forum
Jump to topic

Re: the beautiful indoors

^
The only reason why it's a CGI mockup is because Batman wouldn't let us see the real thing.
by Calshot
Wed Dec 12, 2012 12:33 am
 
Jump to forum
Jump to topic

Re: Review The Last Game You Beat

I actually beat this a long time ago, but I played it again and felt like writing a review about it. And I did.

Tenchu: Shadow Assassins (Wii)

http://img832.imageshack.us/img832/8913/tenchushadowassassinswid.jpg

Story
Like previous Tenchu games, you play as Rikimaru and Ayame, two ninjas in service of daimyo Lord Gohda. Peace has not been completely restored since the events of the previous game. Rumors of impending war circle throughout Lord Gohda's lands. A kunoichi (female ninja) disguised as a fortune-teller kidnaps Lord Gohda's daughter, Princess Kiku, during a divination session to determine the fate of the kingdom. Ayame chases after the kunoichi while Rikimaru continues his investigation on the war rumors.

Graphics
The game was released for the Wii in 2009. While the graphics don't scream "next-gen" (err, current-gen since the next generation is arriving), the graphics aren't anything to scoff at. Some of the outdoor areas are actually quite nice. There can be a few minor hiccups--the camera might be blocked by a wall when doing a stealth kill for example--but it's generally not enough to break immersion.

http://imageshack.us/a/img801/8554/tenchu4artoftheninja200.jpg

Gameplay
The gameplay of Tenchu: Shadow Assassins was criticized as being a step in the wrong direction for the series. Previous games gave the player much more freedom in completing a stage while Shadow Assassins seems almost like a stealth rail-shooter. Rikimaru and Ayame are much more agile in previous games while in Shadow Assassins they control like ninja tanks. Rooftop exploration, a hallmark of the series, is limited and the player is mostly confined to the ground.

One run through a stage all the claims made about the game seem fairly accurate. However, there's a lot more depth than there appears to be at first glance. While there is an "right" path that the game wants you to take in a stage, there are a good number of hidden, alternative pathways and secret areas, some only accessible when using items from other stages. The items themselves add a good amount of depth to the game. There are 10 unique items to use (excluding bonus and secret items) which range from conventional ninja gear like smoke bombs and assorted throwing weapons to more unusual equipment like fishing rods and ninja cats. These items have obvious uses that the game introduces to you as well as undocumented features.

http://imageshack.us/a/img708/7928/fatkittyobservation6.jpg
It may look like animal abuse, but trust me, ninja cat can take it.

Controls
Like other Wii games released around the same time, it has the obligatory waggle controls. While the controls certainly are gimmicky, they work (for the most part). The game may fail to recognize a motion, but it recognizes most of them and it is generally only a mild inconvenience.

There are a few differences between Rikimaru and Ayame, but they okay mostly the same. Rikimaru controls like the aforementioned ninja tank, but is stronger than Ayame, i.e. he moves near the same speed when he's carrying a box or body. Ayame is speedier and feels much more like a traditional video game ninja, but is weaker than Rikimaru.

Both Azuma Clan ninjas don't move super smoothly since the control is completely digital for some reason. I don't know if it was by design or not, but it seems to work with the new approach this game takes compared to the previous ones (though I admittedly only played a few hours collectively of the first two PS1 games). The controls may not allow you to flip out like crazy slaughtering samurai left and right, but they force you to take your time and plan out your moves lest you get discovered.

http://imageshack.us/a/img843/5995/screenshotwiitenchushad.jpg

One area Shadow Assassins doesn't fail to deliver in is its stealth kills, also known as hissatsu. There is plenty of neck-snapping, slice 'n dicing, conflagration, drowning, etc. kills to please everyone. Off the top of my head, there around 30-40 unique hissatsu factoring in the item and environmental-based ones. Some hissatsus are more convincing than the others.

http://imageshack.us/a/img708/9937/drsnibvlbbvc9tcxiooakni.jpg
This is a fetish somewhere, I'm sure.

Swordplay
If unarmed, the character you're playing as prefers to flee back to the last checkpoint if discovered by an enemy. If equipped with a sword, then the character will engage the enemy in duel. The swordplay isn't very good and would have benefited from the invention of the motion plus accessory. Basically, there's an attack phase and a defense phase. During the defense phase, you have to hold the Wiimote perpendicular to the angle the enemy is attacking. After the "tenchu" bar fills up, you enter the attack phase. The game points at arrows on the enemy for you to hit for extra damage, but since the attack phase has a time limit and the Wiimote isn't very accurate in detecting where you hit, it's just easier to make random cuts until the enemy is dead or the attack phase ends.

The game seems to discourage combat. If an attack is blocked improperly, your sword takes damage. If it takes too much damage, it breaks and you flee combat. If you miss blocking an attack entirely, than you flee combat (except in unavoidable boss fights, in which case you get a total of three missed hits before you lose). The Wiimote is okay at detecting the angle you're holding the Wiimote at lower speeds, but as the game throws enemies who have much higher health and attack in a faster/higher frequency at you, you're very likely to make a mistake. You can adjust the difficulty of the sword fighting at any time through the options in the pause menu. If you don't care very much and just want to get through the sword matches, you can always "cheat" by pausing, aligning the Wiimote correctly, and then unpausing.

http://imageshack.us/a/img441/8514/tenchu4c.jpg


Audio
Unlike past games, there's no option to switch to a Japanese dub (to my memory at least). Fortunately, the English dub isn't terrible. There are a few out-of-place elements (one or two minor characters have English accents for some reason) and some of the guard dialogue when detected can get pretty annoying, but it's otherwise pretty decent.

The soundtrack is actually quite good and utilizes a variety of traditional string and woodwind instruments. The downside is that, given the lengths of the stages, the music tracks tend to repeat often.

I posted this track in the video game music topic but I'm re-posting it here as an example.
http://www.youtube.com/watch?v=eAeT3B_kZ-U

Final Thoughts
However, when judged on its own merits, Tenchu: Shadow Assassins is still a fun and solidly-made game. The main story should take around 10-20 hours. There are also 50 side missions called "assignments" for you to do as well as a hard mode of each story stage. There are also hidden map/mask pieces for you to collect in the main story stages that unlock secret items. If you really hate the motion controls that bad, there is a PSP port. I don't really know the differences between the versions other than that the PSP port has longer loading screens (and the lack of motion controls of course).
by Calshot
Sun Dec 16, 2012 1:55 am
 
Jump to forum
Jump to topic

Re: Gaming thoughts of the day

^
If I remember correctly, it was thought that, since most people are right handed, people would be confused when they were swinging the Wiimote with their right hand and Link would be swinging with his left.
by Calshot
Wed Dec 19, 2012 1:20 am
 
Jump to forum
Jump to topic

Re: Last Game/System/Peripheral You Bought

I bought the latest Humble Bundle and then the son of the man who did this

[youtube]http://www.youtube.com/watch?v=4eYPbXg3QAo[/youtube]

did something similar to me and left me a copy of Darksiders 2.
by Calshot
Fri Dec 21, 2012 6:44 pm
 
Jump to forum
Jump to topic

Re: What Game/Games Are You Currently Playing?

I beat Saints Row 3 yesterday (got it in the THQ Humble Bundle a couple of weeks ago). I had a lot of fun with it and since the last GTA-style game I played was Vice City years ago, the gameplay didn't feel stale to me.

I'm either going to play Psychonauts or Darksiders 2 next.
by Calshot
Fri Dec 21, 2012 6:56 pm
 
Jump to forum
Jump to topic
Powered by phpBB © 2000-
ShenmueDojo.net