General Anime Discussion

(Discuss literally anything here including introductions)

Re: What Anime are you watching right now?

Postby Dorian » Fri Oct 12, 2012 10:05 pm

I just rewatched Vampire Hunter D.

I was convinced that it's not going to stand the test of time, but I only loved it more than ever. There was no better way to squeeze that novel material into a 80 minutes anime back then. A true classic in which I wouldn't change even one frame. I even like the ending music, though, so you can call me a drity fanboy. Just watch your neck...

Dorian has received a thanks from: ThyDarkAngel
Dorian
Banned
Banned
 
Joined: August 2007
Location: Poland
PSN: Takehaniyasubiko
Favorite title: Shenmue II
Currently playing: stuff

Re: What Anime are you watching right now?

Postby KiBa » Sat Oct 13, 2012 12:05 am

I might give it a try. Been looking for some good Halloween anime.
User avatar
KiBa
selfaware
"Keep Friends"
 
Joined: January 2006

Re: What Anime are you watching right now?

Postby Bluecast » Sat Oct 13, 2012 12:14 am

I wish someone here other than me would watch Morbito. Honestly one of the best I ever seen.

Bluecast has received a thanks from: KiBa
User avatar
Bluecast
Jean Valjean
Banned
 
Joined: August 2003
PSN: Ryudoadam
XBL: Dogi99
Nintendo FC: Segata
Steam: Ryudo2k9
Favorite title: Shenmue
Currently playing: Some weeb game as always.

Re: What Anime are you watching right now?

Postby Dorian » Sat Oct 13, 2012 12:30 am

KiBa wrote: I might give it a try. Been looking for some good Halloween anime.

Bloodlust is vastly superior, but the original one has the '80s spirit nailed down and I love it.
Last edited by Dorian on Sat Apr 14, 2018 8:30 am, edited 1 time in total.
Dorian
Banned
Banned
 
Joined: August 2007
Location: Poland
PSN: Takehaniyasubiko
Favorite title: Shenmue II
Currently playing: stuff

Re: What Anime are you watching right now?

Postby KiBa » Sat Oct 13, 2012 1:10 am

^ Good to know.

Bluecast wrote: I wish someone here other than me would watch Morbito. Honestly one of the best I ever seen.


I watch Moribito. It's great.
User avatar
KiBa
selfaware
"Keep Friends"
 
Joined: January 2006

Re: What Anime are you watching right now?

Postby Thief » Sun Oct 14, 2012 7:46 am

Just finished Anohana. It was pretty good, had some really great characters but the show itself tried too hard to be sad.. it had its moments but overall it was just not very effective. It's worth watching just because of the characters though, you'll hate them all.... but then you'll love them! Hurray!

Anyway here's the opening, couldn't find it on youtube...

User avatar
Thief
LAMEWAD
Machine Gun Fist
 
Joined: December 2010

Re: What Anime are you watching right now?

Postby KiBa » Sun Oct 14, 2012 8:02 am

Never heard of that show before. It looks good. Thanks for the post, LAMEWAD.
User avatar
KiBa
selfaware
"Keep Friends"
 
Joined: January 2006

Re: What Anime are you watching right now?

Postby mrslig100 » Sun Oct 14, 2012 11:04 am

None, I don't like anime.
User avatar
mrslig100
Alpha Trading Boss
Alpha Trading Boss
 
Joined: May 2012
Location: Land of teh lulz
Steam: mrslig100
Currently playing: shenmue 3 fandom

Re: What Anime are you watching right now?

Postby Rakim » Sun Oct 14, 2012 6:19 pm

Crayon Shinchan. One of the funniest anime out there.
Rakim
Machine Gun Fist
Machine Gun Fist
 
Joined: July 2004
Favorite title: Shenmue II

Re: What Anime are you watching right now?

Postby Dorian » Mon Oct 15, 2012 6:17 am

Now I'm moving onto Shin Megami Tensei: Tokyo Mokushiroku/Tokyo Revelation. Sweet stuff, but SMT fans should know that it's based on the SMT manga by Suzuki Kazunari and Ogishima Chiaki, a manga which is very loosely related to the games.

I'd like to go back to the Megami Tensei anime from the 80s, the one I talked about earlier.

It's actually pretty weak overall (too short and cheesy, and it was intended as a starting point for what never followed, lol), but there are some cool bits of it.

In an interesting twist of fate, Tony from Digital Devil Database managed to buy some cels from this anime!

Image
Dorian
Banned
Banned
 
Joined: August 2007
Location: Poland
PSN: Takehaniyasubiko
Favorite title: Shenmue II
Currently playing: stuff

Re: What Anime are you watching right now?

Postby KiBa » Sat Oct 27, 2012 2:55 am

I just noticed for the first time something interesting in Cowboy Bebop, and I'm sure probably everyone noticed it but me, but for anyone who has finished it
as you know, Spike's right eye was a fake the whole time - he lost it in a fight years before. At the end of the last episode, The Real Folk Blues - Part II, when he stumbles down the broken escalator after the final fight with Vicious, just before he points at the remaining syndicate and says "Bang!" he is now missing his left eye as well. Kind of gave me the creeps, since I never thought that detail through before.

KiBa has received 2 thanks from: OL, wude
User avatar
KiBa
selfaware
"Keep Friends"
 
Joined: January 2006

Re: What Anime are you watching right now?

Postby AnimeGamer183 » Sat Oct 27, 2012 2:05 pm

Kibas avatar makes sense now.

AnimeGamer183 has received 2 thanks from: KiBa, wude
User avatar
AnimeGamer183
Shenmue III
Shenmue III
 
Joined: April 2003

Re: What Anime are you watching right now?

Postby Calshot » Thu Nov 08, 2012 10:52 pm

I was sitting in the lab for my molecular biology class and the professor had written down an example of a DNA sequence of a certain allele. It went something like this:

CCCTCATTCATTCATTCATCA

In my sleep-deprived state of my mind, I read that as

ATATATATATATATATATATATAT

For the next five minutes I wondered what class would be like if Kenshiro taught it before realizing that I should probably be paying attention.

Calshot has received a thanks from: OL
User avatar
Calshot
Volare!
Alpha Trading Boss
 
Joined: January 2008
Location: Bay Area, California
PSN: SoLongAgo
Steam: Vodkakui

Re: What Anime are you watching right now?

Postby OL » Fri Nov 09, 2012 1:35 am

:lol:
Chances are, that's actually what Kenshiro's DNA sequences look like.
So much explained.
User avatar
OL
Yo jes hummilated yoursef
Shenmue III
 
Joined: May 2003

Re: What Anime are you watching right now?

Postby ShenmueTree » Sun Nov 11, 2012 11:39 am

Hyouka. The translation is horrible.
ShenmueTree
"After Burner...Great!"
"After Burner...Great!"
 
Joined: April 2012

PreviousNext

Return to Off Topic

Who is online

Users browsing this forum: Majestic-12 [Bot] and 1 guest

Powered by phpBB © 2000-
ShenmueDojo.net